HCV RNA Decline in Chronic Hcv Genotype 2 and 3 During Standard of Care Treatment According to IL28B Polymorphism

Journal of Viral Hepatitis

HCV RNA Decline in Chronic Hcv Genotype 2 and 3 During Standard of Care Treatment According to IL28B Polymorphism

Medscape

Abstract and Introduction
Abstract
The IL28 gene is highly associated with sustained viral response (SVR) in patients infected with genotype 1 after standard of care (SOC) treatment with peg-IFN and ribavirin. It is also associated with a steeper first phase HCV RNA decline during treatment. In genotype 2 and 3 infections, these correlations are less obvious. We studied the IL28B association to rapid viral response (RVR), SVR, first and second phase HCV RNA decline during treatment in 100 HCV mono-infected and 13 HCV/HIV co-infected patients. We found a significantly higher mean baseline HCV RNA level in IL28B SNP CC than non-CC mono-infected patients, 6.99 vs 6.30 log₁₀ IU/mL (P = 0.02), and a significantly larger median 1st phase decline in patients with CC than non-CC genotype, 2.03 vs 1.37 log₁₀ IU/mL, respectively. The overall SVR rate in HCV mono-infected patients was 87% vs 77% in HCV/HIV co-infected patients, with no correlation to IL28B SNP. In mono-infected patients with RVR, the SVR rate was high and independent of IL28B genotype. In mono-infected patients who failed to achieve RVR who had IL28B CC and non-CC genotype, 64% and 67% achieved SVR, respectively. In genotype 2 and 3 infected patients, the 1st phase HCV RNA decline was steeper in patients with IL28B CC vs non-CC genotype during SOC treatment. This did not translate into a higher frequency of RVR or SVR. Hence, the clinical relevance of pretreatment analysis of IL28B polymorphisms in genotype 2 and 3 infected patients can be questioned in patients with expected high SVR rate.

Introduction
Hepatitis C (HCV) is a major cause of morbidity and mortality in HCV mono-infected and HCV/HIV co-infected patients.^[1,2] In those who achieve sustained viral response (SVR) with standard of care treatment (SOC) with peg-interferon (peg-IFN) and ribavirin (RBV), the long-term outcome is improved.^[3] The current HCV treatment, however, is associated with frequent side effects, a high cost, and the access to treatment is variable, and only a minority of HCV/HIV co-infected patients are offered SOC treatment.^[4] To promote treatment further, identification of the patient who is most likely to respond is important.

Several important factors predictive of SOC treatment response such as age, fibrosis stage, genotype and viral load are well known.^[5,6]

Recently, the single-nucleotide polymorphism (SNP), rs12979860, near the IL28B gene (coding for IFN-lambda-3) has shown a strong association with SVR after SOC treatment both in HCV mono-infected and HCV/HIV co-infected genotype 1 patients.^[7–9] The IL28B SNP also correlates with a faster 1st and 2nd phase decline of the viral load during SOC treatment in genotype 1 infections and a more frequent rapid viral response (RVR) rate.^[10] In genotype 2 and 3 infected patients, this association seems to be less pronounced.^[11–14] Hence, IL28B correlation to RVR and non-RVR has yielded divergent results.^[11–13,15] In this study, the correlation of the IL28B SNP and HCV RNA decline during the 1st and 2nd phase of SOC treatment in genotypes 2 and 3 infected HCV patients was studied, in both HCV mono- and HCV/HIV co-infected patients. We also correlated the IL28B gene polymorphism to RVR and SVR in these patients.

Material and Methods
Demographics
Patients were recruited at the Karolinska University Hospital Huddinge, Stockholm, Sweden, as described earlier.^[16–18] In total, 100 consecutive HCV mono-infected and 13 HCV/HIV co-infected naive genotype 2 or 3 patients were studied. Patients with chronic hepatitis B, other concomitant liver diseases, ongoing substance abuse or severe psychiatric disease were excluded.
Ten of 13 co-infected patients had had undetectable HIV RNA levels on antiretroviral treatment (ART) for a minimum of 6 months prior to inclusion. Three co-infected patients had not yet initiated ART, all with CD4 T-cell counts above 350.
Liver biopsies are not performed in genotype 2 and 3 infected patients according to the Swedish consensus guidelines, which allows treatment without histological evaluation.
Gothenburg University Cirrhosis Index (GUCI) and ASAT to platelet ratio (APRI) scores were used to have an estimate if advanced or nonadvanced stage of fibrosis was at hand.

Hepatitis C Treatment
All patients were treated with SOC consisting of peg-IFN alpha-2a (Pegasys, Welwyn Garden City, UK) 135 μg/week and RBV (Copegus, Roche AB, Stockholm, Sweden) 11 mg/kg/day during 24 weeks according to Swedish consensus guidelines.^[19]
Ninety-seven percentage of mono-infected and all co-infected patients completed a full 24 weeks treatment course.

Virological Methods
Hepatitis C virus-RNA levels were measured at baseline, day 2, week 1, 2, 4, 12, 24 and week 48 and analysed by Roche Taqman Real-Time PCR (detection limit of 15 IU/mL).^[20]
Hepatitis C virus genotyping was performed with a line probe assay (Inno-LiPA HCV II, Innogenetics NV, Gent, Belgium) or an in-house method.^[21]

rs12979860 SNP Genotyping
Genotyping for the IL28B rs12979860 SNP was performed with an in-house Taqman-based allele-specific PCR method on DNA extracted from frozen EDTA plasma. The SNP was defined as rs12979860 genotype CC, CT or TT.
The following primers and probes were used: rs12979860 forward, GCCTGTCGTGTACTGAACCA; rs12979860 reverse, GCGCGGAGTGCAATTCAAC; probe C, FAM-CTGGTTACGCCTTC-MGB; probe T, VIC-TGGTTCGCGCCTTC-MGB.

HCV RNA Decline
The viral decline was analysed during the 1st phase, defined as the decline in HCV RNA levels from baseline to treatment day 2, and 2nd phase as the decline in HCV RNA levels from HCV RNA day 2 to treatment week 2 or 4. RVR was defined as negative (<15 IU/mL) HCV RNA at week 4. Complete early viral response (cEVR) was defined as negative HCV RNA week 12. Partial EVR (pEVR) was defined as at least a 2 log 10 drop in HCV-RNA levels from baseline to treatment week 12. Patients who failed to achieve pEVR stopped treatment. End of treatment response (ETR) was defined as negative HCV RNA at treatment cessation (week 24) and SVR also at 6-month follow-up after treatment.

Statistics
The primary end point was to study whether the 1st and 2nd phase HCV RNA decline in mono- and in co-infected patients varied according to IL28B genotype CC or CT/TT (non-CC).
Furthermore, the absolute HCV-RNA values at baseline, day 2, week 1, 2 and 4 were analysed according to CC or CT/TT (non-CC) genotype.
Hepatitis C virus RNA levels of < 15 IU/mL were set to 14 IU/mL for statistical analysis.
The chi-square test or Fisher's exact two-tailed test was used to test categorical variables.
The Wilcoxon rank sum test was used for continuous variables. A P-value <0.05 was judged to be statistically significant.

Ethics
The study was performed in accordance with the Helsinki declaration and was approved by The Local Ethics committee. The study persons gave their informed written consent.

Results
Demographics
Mono-infected: A total of 100 consecutive HCV mono-infected patients treated with SOC were included. A majority (94%) of our patients were Caucasians. There were 48 males (48%) with a median age of 45 years. HCV genotype 3 was seen in 59%. Overall the baseline median HCV RNA was 6.67 log 10 IU/mL.

An estimate of the fibrosis stage (advanced vs nonadvanced) was made based on the duration of the HCV infection, and by the APRI and GUCI fibrosis scores.^[22,23]
The median disease duration was 23 years. The median GUCI score was 0.58 in mono-infected patients. The APRI scores were not significantly different in any patient group.
Co-infected patients: A total of 13 HCV/HIV co-infected with a mean age of 51 years were treated and included, whereof 85% were Caucasians. Of these 11 (85%) were males. HCV genotype 3 was found in 69%. Overall the baseline median HCV RNA was 6.49 log 10 IU/mL. The median disease duration was 31 years, and not different from that in mono-infected patients (P = ns). The median GUCI score was 0.71.

The baseline demographics according to IL28B genotype CC vs non-CC in HCV mono- and HCV/HIV co-infected patients are given in Table 1.
The baseline median HCV RNA in HCV mono-infected patients with the IL28B CC genotype was significantly higher than in patients with the non-CC group; 9 750 000 IU/mL (6.99 log10 IU/mL) vs 2 000 000 IU/mL (6.33 log10 IU/mL), respectively, P = 0.02.

Prevalence of rs12979860 Genotypes in the Study Population According to HCV Genotype
In the 100 mono-infected patients, the overall prevalence of the rs12979860 genotype CC, CT and TT was 44%, 52% and 4%, respectively. The corresponding figures in genotype 2 infected patients were 43%, 55% and 3%, and 46%, 49% and 5% in genotype 3 infected, respectively. In the co-infected patients, the corresponding figures were 46%, 46% and 8%, respectively.

Overall HCV RNA 1st and 2nd Phase Decline According to rs12979860 Genotype
The overall HCV RNA decline during the 1st and 2nd phase decline according to the rs12979860 IL28B genotype in HCV mono- and HCV/HIV co-infected patients is given in Table 2 and Fig. 1. This difference was not seen in the co-infected patients because of the small number of patients included (Table 2).

The absolute median HCV-RNA levels (log₁₀ IU/mL) at different time points during the first 4 weeks of SOC treatment according to IL28B genotype are depicted for HCV mono-infected patients in Fig. 2a, and for the 13 HCV/HIV co-infected patients, the individual HCV-RNA levels according to IL28B genotype CC and non-CC patients are given in Fig. 2b.

1st Phase HCV RNA Decline During SOC Treatment
In the HCV mono-infected patients, the median decline in HCV RNA level from baseline to day 2 (1st phase decline) was significantly higher for patients with the CC than non-CC genotype, 2.03 vs 1.37 log₁₀ IU/mL, respectively (P = 0.01, Figs 1 & 2a).

The corresponding figures in the co-infected patients were 1.49 and 1.30 log₁₀ IU/mL, respectively, for patients with the CC and non-CC (P = 0.78, ns, Figs 1 & 2b).

2nd Phase HCV RNA Decline During SOC Treatment
In the HCV mono-infected patients, the median decline in HCV RNA level from day 2 to week 2 reflecting the 2nd phase decline was 2.00 and 1.58 log₁₀ IU/mL in patients with the CC and CT/TT genotype, respectively (P = 0.11, ns, Figs 1 & 2a).
In the co-infected patients, the corresponding figures were 2.50 vs 0.94 log₁₀ IU/mL (P = 0.20, ns, Figs 1 & 2b).

In the HCV mono-infected patients, the median decline in HCV RNA level from day 2 to week 4, also reflecting the 2nd phase decline, was 3.60 and 3.22 log₁₀ IU/mL, respectively, in patients with the IL28B CC and non-CC genotype (P = 0.14, ns).

In the HCV/HIV co-infected patients, the corresponding figures were 3.10 vs 2.62 log₁₀ IU/mL (P = 0.15, ns). The individual HCV RNA levels during the first 4 weeks treatment in the HCV/HIV co-infected patients are given in Fig. 2 panel c and d according to IL28B genotype CC vs non-CC.

RVR and SVR During SOC Treatment According to IL28B Genotype
RVR and SVR in mono-infected patients according to IL28B genotype are shown in Fig. 3.

The proportion of patients with RVR in mono-infected patients with CC was 74% vs 67% in patients with non-CC SNP (P = 0.41, ns). In HCV/HIV co-infected patients, the corresponding figures were 67% vs 29% (P = 0.17, ns).

In mono-infected patients achieving RVR, the proportion of patients with SVR was high (97%) and independent of rs12979860 genotype.

In mono-infected patients failing to achieve RVR, 64% and 67% with IL28B CC and CT/TT genotype, respectively, achieved SVR (data not shown).

The overall SVR rate in HCV mono-infected patients was 86/99 (87%) vs 10/13 (77%) in HCV/HIV co-infected patients and did not differ according to IL28B SNP. Furthermore, separate analyses of the RVR and SVR rates in genotype 2 and 3 infected patients did not reveal any significant difference according to IL28B genotype (Fig. 3).

The influence of baseline factors such as disease duration, gender, weight, baseline HCV RNA viral load, APRI score as surrogate marker for fibrosis, genotype 2 vs 3 and IL28B SNP CC vs non-CC on RVR and SVR was analysed. In the univariate analyses, no baseline factor was significantly correlated to SVR and only disease duration to RVR (P = 0.04). Baseline HCV RNA was nearly significantly associated with RVR (P = 0.057). As no baseline factor was significantly associated with SVR, no multivariate analysis was performed.

Discussion
In this study, we found a significantly steeper 1st phase HCV RNA decline during standard of care treatment in genotype 2 and 3 mono-infected HCV patients with CC vs CT/TT rs12979860 genotype as recently noted by others in genotype 3 infected^[14] and genotype 2 and 3 infected patients.^[11] A trend towards a more steep 2nd phase decline was also seen in patients with the CC rs12979860 vs non-CC genotype; however, this was not significant. Concerning RVR, however, we found no significant association with the rs12979860 genotype. This possibly reflects the high response rate seen with SOC treatment in genotype 2 and 3 infected patients. Findings in other studies with larger number of genotype 2 or 3 infected patients have yielded conflicting results on the influence of IL28B genotype on RVR rate.^[12–15,24] RVR, however, had a high probability of achieving SVR.^[18]
In our co-infected group, there was no significant difference in HCV RNA kinetics or in the frequency of RVR and SVR. The power to detect such differences, however, was low because of the small number of co-infected persons included.

In an Italian study of mainly genotype 2 infected patients, Mangia et al. found a significant association with SVR and the IL28B genotype CC in patients lacking RVR but not in patients with RVR.^[12] In this study, a trend towards higher baseline HCV RNA viral load was reported in patients with the CC genotype. In the study of Mangia et al., however, few patients with HCV infection caused by genotype 3 were included. In the study by Moghaddam et al. on the contrary, the majority of patients included were infected with genotype 3 and these authors found a significant association with RVR but not SVR in patients with the CC genotype.^[15]

In a German study, Sarrazin et al. reported an association with SVR but not with RVR in IL28B CC genotype patients with both genotype 2 and 3.^[13] In this study, a significant association with higher baseline HCV-RNA viral load was seen in CC patients with genotype 2 and 3 as has previously been described in genotype 1 infected patients.^[7,10,11]

In our study, we found a significant steeper 1st phase HCV RNA decline in genotype 2 and 3 infected patients with the CC genotype than in patients with the non-CC genotypes in line with what has recently been shown in another Swedish study.^[11] We did, however, not find a higher RVR or SVR rate. Our findings were probably caused by the high response rate seen in our genotype 2 and 3 patients, meaning that small differences cannot be discerned. For this, larger patient numbers are needed.

In another recent Scandinavian study mainly consisting of genotype 3 patients, however, the IL28B CC genotype was associated with RVR but not with SVR.^[15] We found that the SVR rate among our patients was similar in genotype 2 and 3 infected patients as was the RVR rate.^[18] Thus, RVR was seen in 70% of our patients and SVR in more than 95% of those achieving RVR, irrespective of whether they were infected with genotype 2 or 3.^[18]

To conclude, we found that the 1st phase HCV RNA decline was steeper in patients with IL28B CC vs in non-CC genotype during standard of care treatment in genotype 2 and 3 infected patients, but that this did not translate into a higher frequency of RVR or SVR. Small differences might be seen in studies including large patient numbers, but the clinical relevance of pretreatment analysis of IL28B genotypes in genotype 2 and 3 infected patients can be questioned because these patients are expected to have high SVR rates anyway.

Source - Medscape

References

1. Volk ML, Tocco R, Saini S, Lok AS. Public health impact of antiviral therapy for hepatitis C in the United States. Hepatology 2009; 50: 1750–1755.
2. Weber R, Sabin CA, Friis-Moller N et al. Liver-related deaths in persons infected with the human immunodeficiency virus: the D:A:D study. Arch Intern Med 2006; 166: 1632–1641.
3. Cardoso AC, Moucari R, Figueiredo-Mendes C et al. Impact of peginterferon and ribavirin therapy on hepatocellular carcinoma: incidence and survival in hepatitis C patients with advanced fibrosis. J Hepatol 2010; 52: 652–657.
4. Falconer K, Sandberg JK, Reichard O, Alaeus A. HCV/HIV co-infection at a large HIV outpatient clinic in Sweden: feasibility and results of hepatitis C treatment. Scand J InfectDis 2009;41: 881–885.
5. Fried MW, Shiffman ML, Reddy KR, Jr et al. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med 2002; 347: 975–982.
6. Manns MP, McHutchison JG, Gordon SC et al. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 2001; 358: 958–965.
7. Ge D, Fellay J, Thompson AJ et al. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 2009; 461: 399–401.
8. Rallon NI, Naggie S, Benito JM et al. Association of a single nucleotide polymorphism near the interleukin- 28B gene with response to hepatitis C therapy in HIV/hepatitis C viruscoinfected patients. AIDS 2010; 24: F23–F29.
9. Thomas DL, Thio CL, Martin MP et al. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature 2009; 461: 798–801.
10. Thompson AJ, Muir AJ, Sulkowski MS et al. Interleukin-28B polymorphism improves viral kinetics and is the strongest pretreatment predictor of sustained virologic response in genotype 1 hepatitis C virus. Gastroenterology 2010; 139: 120–129.
11. Lagging M, Askarieh G, Negro F et al. Response prediction in chronic hepatitis C by assessment of IP-10 and IL28B-related single nucleotide polymorphisms. PLoS ONE 2011; 6: e17232.
12. Mangia A, Thompson AJ, Santoro R et al. An IL28B polymorphism determines treatment response of hepatitis C virus genotype 2 or 3 patients who do not achieve a rapid virologic response. Gastroenterology 2010; 139: 821–827.
13. Sarrazin C, Susser S, Doehring A et al. Importance of IL28B gene polymorphisms in hepatitis C virus genotype 2 and 3 infected patients. J Hepatol 2011; 54: 415–421.
14. Scherzer TM, Hofer H, Staettermayer AF et al. Early virologic response and IL28B polymorphisms in patients with chronic hepatitis C genotype 3 treated with peginterferon alfa-2a and ribavirin. J Hepatol 2011; 54: 866–871.
15. Moghaddam A, Melum E, Reinton N et al. IL28B genetic variation and treatment response in patients with hepatitis C virus genotype 3 infection. Hepatology 2011; 53: 746–754.
16. Karlstrom O, Sonnerborg A, Weiland O. Similar hepatitis C virus RNA kinetics in HIV/hepatitis C virus monoinfected genotype 2 or 3 matched controls during hepatitis C virus combination therapy. AIDS 2008; 22: 899–901.
17. Nilsson J, Weiland O. Effect of control selection on sustained viral response rates in genotype 2/3 HCV mono-infected vs HIV/HCV coinfected patients. Scand J Infect Dis 2010; 42: 533–539.
18. Weiland O, Hollander A, Mattsson L et al. Lower-than-standard dose peg-IFN alfa-2a for chronic hepatitis C caused by genotype 2 and 3 is sufficient when given in combination with weight-based ribavirin. J Viral Hepat 2008; 15: 641–645.
19. Lagging M, Wejstal R, Uhnoo I et al. Treatment of hepatitis C virus infection: updated Swedish Consensus recommendations. Scand J InfectDis 2009; 41: 389–402.
20. Sizmann D, Boeck C, Boelter J et al. Fully automated quantification of hepatitis C virus (HCV) RNA in human plasma and human serum by the COBAS((R)) AmpliPrep/COBAS((R)) TaqMan((R)) System. J Clin Virol 2007; 38: 326–333.
21. Yun Z, Lara C, Johansson B, Lorenzana de Rivera I, Sonnerborg A. Discrepancy of hepatitis C virus genotypes as determined by phylogenetic analysis of partial NS5 and core sequences. J Med Virol 1996; 49: 155–160.
22. Shin WG, Park SH, Jang MK et al. Aspartate aminotransferase to platelet ratio index (APRI) can predict liver fibrosis in chronic hepatitis B. Dig Liver Dis 2008; 40: 267–274.
23. Westin J, Ydreborg M, Islam S et al. A non-invasive fibrosis score predicts treatment outcome in chronic hepatitis C virus infection. Scand JGastroenterol 2008; 43: 73–80.
24. Lindh M, Lagging M, Farkkila M et al. Interleukin 28B gene variation at rs12979860 determines early viral kinetics during treatment in patients carrying genotypes 2 or 3 of hepatitis C virus. J Infect Dis 2011; 203: 1748–1752.